Journal: bioRxiv

Article Title: DNA repair and anti-cancer mechanisms in the longest-living mammal: the bowhead whale

doi: 10.1101/2023.05.07.539748

Figure Lengend Snippet: a , Images of representative fibroblast colonies for tested cell lines after 4 weeks of growth in soft agar. The top panel indicates whether the cell lines in the column below have the indicated protein overexpressed (+), inactivated (-), or expressed in the active endogenous form (WT). Text above individual images indicate for that cell line whether tumor suppressors are inactivated through genetic knockout or SV40 Large T (or LT mutants) or Small T (ST) antigen. Icons in corners of images indicate species. Scale bar is 250 µm. b , Volumetric growth curves for the indicated bowhead whale fibroblast cell lines in mouse xenograft assays. All cell lines shown stably express H-Ras G12V and hTERT in addition to the genotype indicated in the figure legend. Data points represent averages from 3 immunodeficient nude mice injected bilaterally (6 injections) for each cell line, except for TP53 -/- RB1 -/- double knockouts, for which 2 independent cell lines were tested, for a total of 6 mice/12 injections. Experiments were terminated based on endpoints for maximum tumor size or duration of experiment as described in Methods. Images in the legend show a representative mouse for the indicated cell line at the final measured time point. Error bars show SEM. c , Western blot for p53 protein in clonally isolated fibroblast colonies following CRISPR targeting of TP53 . Underlined lanes indicate colonies selected for further validation and experiments. d , Western blot for Rb protein in fibroblast clones following CRISPR targeting of RB1 on an p53 knockout background.

Article Snippet: For p53 activity measurement, 1 x 10 cells of control (WT) and clonally isolated p53 KO cell lines were electroporated with 3 µg p53 firefly luciferase reporter plasmid pp53-TA-Luc (Clontech/Takara) and 0.3 ug renilla luciferase control plasmid pRL-CMV (Promega) on an Amaxa Nucleofector 2b (Lonza).

Techniques: Knock-Out, Stable Transfection, Injection, Western Blot, Isolation, CRISPR, Clone Assay

Journal: bioRxiv

Article Title: DNA repair and anti-cancer mechanisms in the longest-living mammal: the bowhead whale

doi: 10.1101/2023.05.07.539748

Figure Lengend Snippet: a , Western blot for p53 protein in fibroblasts clones following CRISPR targeting of TP53 . Labeled clones were for further validation and experiments. b , Western blot for Rb protein in fibroblast clones following CRISPR targeting of RB1 on p53 knockout background. c , Ratio of firefly:renilla luciferase luminescence in fibroblasts transfected with firefly luciferase reporter of p53 transcriptional activity and renilla luciferase control. Cells were treated with etoposide to induce p53 activity. d , Ratio of firefly:renilla luciferase luminescence in fibroblasts transfected with firefly luciferase reporter of E2F transcriptional activity and renilla luciferase control. Transfected cells were serum starved for 24h and returned to complete medium for 24h before luminescence measurement. Higher E2F activity results from reduced Rb activity. Error bars represent SD. ****p<0.001 (two-tailed t test), n=3.

Article Snippet: For p53 activity measurement, 1 x 10 cells of control (WT) and clonally isolated p53 KO cell lines were electroporated with 3 µg p53 firefly luciferase reporter plasmid pp53-TA-Luc (Clontech/Takara) and 0.3 ug renilla luciferase control plasmid pRL-CMV (Promega) on an Amaxa Nucleofector 2b (Lonza).

Techniques: Western Blot, Clone Assay, CRISPR, Labeling, Knock-Out, Luciferase, Transfection, Activity Assay, Two Tailed Test

Journal: International Journal of Molecular Sciences

Article Title: The Males Absent on the First (MOF) Mediated Acetylation Alters the Protein Stability and Transcriptional Activity of YY1 in HCT116 Cells

doi: 10.3390/ijms24108719

Figure Lengend Snippet: The YY1/146–270 region and the YY1K183 site play important roles in p53RE-mediated downstream target gene transactivation in HCT116 cells. ( A ) The schematic diagram of target genes up- or down-regulated by YY1. ( B ) The schematic diagram of a p53RE-Luc plasmid. Multiple response elements of TP53 were inserted into the pp53-TA-Luc vector. ( C , D ) The effects of YY1 and its truncated mutants on p53RE-Luc luciferase activity and related protein levels. * p < 0.05 or # p < 0.05, compared to the p53RT-Luc group. ( E ) P53 and its downstream protein levels in YY1 knockdown HCT116 cells. ( F ) Effects of YY1 and its point mutants on p21 protein levels. Increasing amounts of YY1wt, YY1K183R, and YY1K258R were transfected into HCT116 cells, and p21 protein levels were analyzed by a Western blot using the anti-p21 antibody. ( G ) The effects of YY1 and MOF on p53RE-Luc luciferase activity. * p < 0.05 or ** p < 0.01 compared to the p53RT-Luc group; ## p < 0.01 or ### p < 0.001 compared to the p53RT-Luc+MOF groups.

Article Snippet: Pp53-TA-Luc plasmid (D2223, Beyotime), including multiple p53 response elements (ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTTGGACATGCCCGGGCTGTC), was obtained from Beyotime Biotechnology (Shanghai, China).

Techniques: Plasmid Preparation, Luciferase, Activity Assay, Transfection, Western Blot

Journal: American Journal of Translational Research

Article Title: MAGEA3 promotes proliferation and suppresses apoptosis in cervical cancer cells by inhibiting the KAP1/p53 signaling pathway

doi:

Figure Lengend Snippet: MAGEA3 interacts with KAP1 and inhibits p53 transcriptional activity. A. Co-IP assays were performed in HeLa cells and SiHa cells cotransfected with Lv-MAGEA3 and pcDNA3.1-KAP1. Cell lysates were immunoprecipitated (IP) with control IgG or the indicated antibody, and the precipitated protein was detected by immunoblotting (IB) analysis with the indicated antibody. Cell extracts were used as a positive control (Input). B. Effects of MAGEA3 or KAP1 on p53 activity, as indicated by the reporter plasmid pp53-TA-luc. HeLa cells (with endogenous wild-type p53) grown on a 12-well plate were cotransfected with the pp53-TA-luc and the indicated plasmids. Luciferase was measured at 48 h posttransfection and normalized according to Renilla luciferase activities. Data (means ± SD) are represented as fold differences relative to that observed in cells without transfecting the indicated plasmids. C, D. Western blotting analysis of the p53 and KAP1 proteins following overexpression or knockdown of MAGEA3 in SiHa (Ca, Cb) and HeLa (Da, Db) cells. *P<0.05, **P<0.01 vs. control groups. E. Immunohistochemical analysis of p53 expression in the Lv-MAGEA3 group and Lv-NC group of xenograft tumors. Bar length: 100 µm.

Article Snippet: Cells were cultured at a density of 5×10 4 cells/well in 12-well plates and cotransfected with the p53-responsive luciferase reporter plasmid (pp53-TA-luc, containing p53 response element, Beyotime, Shanghai, China) along with the Renilla luciferase reporter plasmid (pGMR-TK, Genomeditech, Shanghai, China) for 6 h. Some cells were further transfected with the indicated plasmids or lentivirus.

Techniques: Activity Assay, Co-Immunoprecipitation Assay, Immunoprecipitation, Control, Western Blot, Positive Control, Plasmid Preparation, Luciferase, Over Expression, Knockdown, Immunohistochemical staining, Expressing

Journal: American Journal of Translational Research

Article Title: MAGEA3 promotes proliferation and suppresses apoptosis in cervical cancer cells by inhibiting the KAP1/p53 signaling pathway

doi:

Figure Lengend Snippet: Effects of MAGEA3 expression on the protein levels of p53 downstream targets. A, B. Western blotting analysis of p53, p21, Bax, Bcl2, PUMA, cyclin D1, and cleaved caspase-3 proteins following overexpression or knockdown of MAGEA3 in SiHa (Aa, Ab) and HeLa (Ba, Bb) cells. *P<0.05, **P<0.01 vs. control groups. C. Immunohistochemical analysis of p21 and Bax expression in the Lv-MAGEA3 group and Lv-NC group of xenograft tumors. Bar length: 100 µm.

Article Snippet: Cells were cultured at a density of 5×10 4 cells/well in 12-well plates and cotransfected with the p53-responsive luciferase reporter plasmid (pp53-TA-luc, containing p53 response element, Beyotime, Shanghai, China) along with the Renilla luciferase reporter plasmid (pGMR-TK, Genomeditech, Shanghai, China) for 6 h. Some cells were further transfected with the indicated plasmids or lentivirus.

Techniques: Expressing, Western Blot, Over Expression, Knockdown, Control, Immunohistochemical staining

Journal: American Journal of Translational Research

Article Title: MAGEA3 promotes proliferation and suppresses apoptosis in cervical cancer cells by inhibiting the KAP1/p53 signaling pathway

doi:

Figure Lengend Snippet: Nutlin3 reverses the effects of MAGEA3 overexpression on the p53 signaling pathway, cell cycle, and apoptosis. A. Flow cytometric analysis of the cell cycle and apoptosis after treatment with Nutlin3 (10 μM) for 48 h. B. Western blotting analysis of the indicated proteins after treatment with Nutli3 (10 μM) for 48 h. *P<0.05, **P<0.01 vs. Lv-NC; ##P<0.01 vs. Lv-MAGEA3.

Article Snippet: Cells were cultured at a density of 5×10 4 cells/well in 12-well plates and cotransfected with the p53-responsive luciferase reporter plasmid (pp53-TA-luc, containing p53 response element, Beyotime, Shanghai, China) along with the Renilla luciferase reporter plasmid (pGMR-TK, Genomeditech, Shanghai, China) for 6 h. Some cells were further transfected with the indicated plasmids or lentivirus.

Techniques: Over Expression, Western Blot